Sweet victory! The EU Regulation on Advanced Therapies has been adopted by the European Parliament at first reading, in the plenary session of 25 April, and by the Council of Ministers on 30-31 May. It is the first time a regulation is adopted at first reading within the Commission's co-decision procedure and against the recommendation of the rapporteur. The compromise package was approved by 403 votes against 246, with 11 abstentions.

We have gained a regulation that addresses most of the needs and expectations expressed in Eurordis' position papers. We have gained a regulation that will speed up the authorisation process for gene, cell, and tissue engineering therapies. We have gained improved EU-centralised quality evaluation for these very innovative and promising therapies and quality follow up after their authorisation. We have gained better competitiveness for Europe, with a clear, regulated framework. Hopefully we are also putting an end to unethical practices of neighbouring countries offering cell therapy in damaging medical and financial conditions for desperate patients. And once again we will be part of the decision making process: seats are reserved for patient representatives in the EMEA's Committee for Advanced Therapies (CAT) to be created next year.

Through this one year battle against a few Members of the Parliament not following the rules of democracy and willing to impose their personal beliefs to all citizens of the EU against the interest of patients, we have gained higher respect than ever for Eurordis in the world of EU policy making. Every key stakeholder in Brussels, including the Commission, Members of the Parliament, and journalists acknowledge the crucial role played by Eurordis, supported by all EU patient umbrella groups. With our advocacy work in favour of embryonic stem cell regulated research and therapies respecting the needs and wishes of families, we have fought a more frontal battle, based on the key principles of freedom of research, right for hope and respect for life. We have fought courageously with solid arguments. We haven't been afraid to stand up and name those with a hidden agenda. We have proven the strength of our network and the consistency of our argumentation.

Let's take a breath of fresh air. 10 years ago - even only 5 - many didn't believe in the possibility of working together across all European countries and all rare diseases. We wanted to build a rare disease community with a strong voice to reduce - directly or indirectly- the impact of rare diseases on people's lives. We have now turned this vision into reality. Let's enjoy our freedom and the pleasure of working together, of building this house for the sake of a good cause, our cause. Let's reinforce our self-esteem, together, to be ready for the battles and challenges of the next ten years!

Yann Le Cam
Chief Executive Officer

For more information:
Read the Regulation on Advanced Therapies and relevant information from the EC
Read the Eurordis press release following adoption of the Regulation (April 2007)
Read Eurordis' contribution to the consultation paper and draft regulation on advanced therapies (June 2005)
Read Eurordis' position paper on embryonic stem cell (September 2006)
Read European Patients' Statement (April 2007)
Read Call to MEPs to support the compromise package (April 2007)
 

Prevention of corneal graft rejection
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)

Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated)
Pralatrexate

New designations February 07

Treatment of Graft-versus-Host disease
Ex-vivo cultured adult human mesenchymal stem cells

All Orphan Drugs in Europe (in English) >

European Public Assessment Reports (EPARs)(multilingual) >

Editorial Team: Yann Le Cam, Jérôme Parisse-Brassens (Editor and Writer), Julia Fitzgerald, Nathacha Appanah (Writer), David Oziel (Site of the Month), Anja Helm, François Houÿez

Translation Team: Conchi Casas Jorde (Spanish), Ana Cláudia Jorge and Victor Ferreira (Portuguese), Roberta Ruotolo (Italian), Trado Verso (French), Ulrich Langenbeck (German)

© 2007 Eurordis